2.10.2011

Ciput bikin Imut

assalamualaikum cantik... :)
sekarang ini lagi musim banget deh yang namanya ciput mesir
bikin hijabers makin stylish..
selain itu bikin rapi, anakan rambut gak lari kemana mana
dan..cocok bgt buat yang suka pake pasmina..

tapi banyak yang gak pede deh make ciput mesir,,
alasanya bentuk muka begini begitu bla bla bla ble ble ble...

kek halnya baju dan hijab, benernya semua bentuk muka pantes kok pake ciput mesir,,
cuman emang musti mengenali bentuk wajah dulu...
mau kalian punya bentuk muka lonjong, bulet , kotak, sesuaikan cara make ciput mesinya

kalo bentuk muka bulet pastikan ciput mesir nya cuma menutupi separo dahi jangan sampe mendekati alis, karna kalo semakin mendekati alis, muka akan terlihat semakin bukat karna ciput menutupi semua bagian dahi

buat yang bentuk mukanya lonjong, pemakaian ciput mesir pastikan pinggiran ciput mesir terletak di dekat alis atau menutupi dahi, ini membuat wajah semakin proposional..





yg berwajah kotak, tunjukkan ciput nya sedikit saja dibalik kerudung atau syal.


jadi gimanapun bentuk muka kita, tetep bisa donk ikutan make ciput,,,
semoga berguna yaaa...

regards..

7.12.2010

flu singapore

assalamualaikum..
hari sabtu kemaren baru aja pulang dari jakarta langsung keponorogo tempat ibuk..selama di jakarta rayya d sana..
nyampe rumah jam 6 pagi rayya nya lagi leyeh leyeh d depan tivi
"ebboookkk....yayya lagi nntn sepombobob skuelpans"
loh kok suaranya serak gini..
kung nya bilang semalem rayya demam, cuma udah turun  kasih minum sanmol

Hari minggu malam  muncul bintik/ruam di tubuh rayya, mau kedokter kok hari minggu 
baru deh pagi ini ke dokternya. Khawatir cacar, eh ternyata dokter mendiagnosa Rayya tertular virus HFMD.
Jika “dunia” lebih mengenalnya dengan sebutan flu singapura, di Indonesia sudah lama dikenal sebagai penyakit Tangan, Kaki dan Mulut.
Sesuai dengan namanya, virus ini memang menyerang daerah sekitar tangan, kaki, dan mulut penderitanya. Awalnya saya juga tidak mengira si kecil saya terkena flu singapur, tapi begitu dokter “mempelajari” bintik/ruam dan pola penyebarannya di tangan, kaki, dan mulut Rayya … dan membuktikannya dengan menemukan ulkus (semacam sariawan) di rongga mulut, lidah dan pipi dalam Rayya, akhirnya saya pasrah waktu dokter berkata Rayya poitif flu singapura. Hiks, anakku tertular virus populer yang tidak kuinginkan :(


Kata dokter, penyakit ini sangaaaaaaaaat menular.
Dan ….. (maaf) berbahaya kalau tidak ditangani dengan cepat dan tepat, Hiii ngeri, naudzubillah, masa katanya kalau sampai komplikasi bisa menyerang otak (meningitis), jantung, atau membuat lumpuh. Sebagai pengobatan, dokter memberikan obat untuk Rayya anti virus, vitamin dan cairan antiseptik.
Dan karena daya tahan tubuh dipastikan sedang turun, agar tidak menjadi parah dan tentunya menular ke yang lain, sementara untuk waktu kurang lebih seminggu Rayya disarankan “dikarantina”. Blas tidak boleh keluar rumah, apalagi sekolah. Satu pesan dokter untuk saya, jika di hari ke-4  masih menujukkan salah satu gejala, tetap demam >37, lemah, dan tidak nafsu makan … maka saya harus kembali ke dokter.
Aduh, mudah-mudahan tidak sampai kembali ke dokter ya, mohon doanya teman-teman untuk kesembuhan my lil star lady

buat yang mau tau flu singapore lebih jelas ini aku copy in infonya dari  http://medicastore.com/
Flu Singapore atau Hand Foot Mouth Disease (HFMD)
DEFINISI
“Flu Singapore” sebenarnya adalah penyakit yang di dunia kedokteran dikenal sebagai Hand, Foot, and Mouth Disease (HFMD) atau dalam bahasa Indonesia Penyakit Tangan, Kaki, dan Mulut (PTKM).
Penyakit ini sesungguhnya sudah lama ada di dunia. Berdasar laporan yang ada, kejadian luar biasa penyakit ini sudah ada di tahun 1957 di Toronto, Kanada. Sejak itu terdapat banyak kejadian di seluruh dunia. Di Indonesia sendiri sebenarnya penyakit ini bukan penyakit baru.
Istilah ?Flu Singapore? muncul karena saat itu terjadi ledakan kasus dan kematian akibat penyakit ini di Singapura. Karena gejalanya mirip flu, dan saat itu terjadi di Singapura (dan kemudian juga terjadi di Indonesia), banyak media cetak yang membuat istilah ?flu Singapore?, walaupun ini bukan terminologi yang baku.
PENYEBAB
PTKM ini adalah penyakit infeksi yang disebabkan oleh virus RNA yang masuk dalam famili Picornaviridae (Pico, Spanyol = kecil ), Genus Enterovirus ( non Polio ). Genus yang lain adalah Rhinovirus, Cardiovirus, Apthovirus. Di dalam Genus enterovirus terdiri dari Coxsackie A virus, Coxsackie B virus, Echovirus dan Enterovirus.
Penyebab PTKM yang paling sering pada pasien rawat jalan adalah Coxsackie A16, sedangkan yang sering memerlukan perawatan karena keadaannya lebih berat atau ada komplikasi sampai meninggal adalah Enterovirus 71. Berbagai enterovirus dapat menyebabkan berbagai penyakit.
EPIDEMIOLOGI:
Penyakit ini sangat menular dan sering terjadi dalam musim panas. PTKM adalah penyakit yang kerap terjadi pada kelompok masyarakat yang padat dan menyerang anak-anak usia 2 minggu sampai 5 tahun ( kadang sampai 10 tahun ). Orang dewasa umumnya lebih kebal terhadap enterovirus, walau bisa juga terkena.
Penularannya melalui jalur fekal-pral (pencernaan) dan saluran pernapasan, yaitu dari droplet (butiran ludah), pilek, air liur, tinja, cairan vesikel (kelainan kulit berupa gelembung kecil berisi cairan) atau ekskreta. Penularan kontak tidak langsung melalui barang, handuk, baju, peralatan makanan, dan mainan yang terkontaminasi oleh sekresi itu. Tidak ada vektor tetapi ada pembawa (?carrier?) seperti lalat dan kecoa.
Penyakit ini memberi imunitas spesifik, namun anak dapat terkena PTKM lagi oleh virus strain Enterovirus lainnya.
Masa Inkubasi 2 ? 5 hari.
GEJALA
Mula-mula demam tidak tinggi 2-3 hari, diikuti sakit leher (faringitis), tidak ada nafsu makan, pilek, gejala seperti ?flu? pada umumnya yang tak mematikan. Timbul vesikel yang kemudian pecah, ada 3-10 ulkus di mulut seperti sariawan ( lidah, gusi, pipi sebelah dalam ) terasa nyeri sehingga sukar untuk menelan.
Bersamaan dengan itu timbul rash/ruam atau vesikel (lepuh kemerahan/blister yang kecil dan rata), papulovesikel yang tidak gatal ditelapak tangan dan kaki. Kadang-kadang rash/ruam (makulopapel) ada dibokong. Penyakit ini umumnya akan membaik sendiri dalam 7-10 hari, dan tidak perlu dirawat di rumah sakit.
Bila ada gejala yang cukup berat, barulah penderita perlu dirawat di rumah sakit. Gejala yang cukup berat tersebut antara lain :
- Hiperpireksia, yaitu demam tinggi dengan suhu lebih dari 39 C. - Demam tidak turun-turun - Takikardia (nadi menjadi cepat) - Takipneu, yaitu napas jadi cepat dan sesak - Malas makan, muntah, atau diare berulang dengan dehidrasi. - Letargi, lemas, dan mengantuk terus - Nyeri pada leher, lengan, dan kaki. - Kejang-kejang, atau terjadi kelumpuhan pada saraf kranial - Keringat dingin - Fotofobia (tidak tahan melihat sinar) - Ketegangan pada daerah perut - Halusinasi atau gangguan kesadaran
Komplikasi penyakit ini adalah :
- Meningitis (radang selaput otak) yang aseptik - Ensefalitis (radang otak) - Myocarditis (Coxsackie Virus Carditis) atau pericarditis - Acute Flaccid Paralysis / Lumpuh Layuh Akut (?Polio-like illness? )
Satu kelompok dengan penyakit ini adalah :
1. Vesicular stomatitis dengan exanthem (PTKM) - Cox A 16, EV 71 (Penyakit ini)
2. Vesicular Pharyngitis (Herpangina) - EV 70
3. Acute Lymphonodular Pharyngitis - Cox A 10
DIAGNOSA
LABORATORIUM :
Sampel ( Spesimen ) dapat diambil dari tinja, usap rektal, cairan serebrospinal dan usap/swab ulcus di mulut/tenggorokan, vesikel di kulit spesimen atau biopsi otak.
Spesimen dibawa dengan ?Hank?s Virus Transport?. Isolasi virus dengan cara biakan sel dengan suckling mouse inoculation. Setelah dilakukan ?Tissue Culture?, kemudian dapat diidentifikasi strainnya dengan antisera tertentu / IPA, CT, PCR dll. Dapat dilakukan pemeriksaan antibodi untuk melihat peningkatan titer.
Diagnosa Laboratorium adalah sebagai berikut :
1. Deteksi Virus :
- Immuno histochemistry (in situ)
- Imunofluoresensi antibodi (indirek)
- Isolasi dan identifikasi virus.
Pada sel Vero ; RD ; L20B
Uji netralisasi terhadap intersekting pools
Antisera (SCHMIDT pools) atau EV-71 (Nagoya) antiserum.
2. Deteksi RNA :
RT-PCR
Primer : 5? CTACTTTGGGTGTCCGTGTT 3?
5? GGGAACTTCGATTACCATCC 3?
Partial DNA sekuensing (PCR Product)
3. Serodiagnosis :
Serokonversi paired sera dengan uji serum netralisasi terhadap virus EV-71 (BrCr, Nagoya) pada sel Vero.
Uji ELISA sedang dikembangkan.
Sebenarnya secara klinis sudah cukup untuk mendiagnosis PTKM, hanya kita dapat mengatahui apakah penyebabnya Coxsackie A-16 atau Enterovirus 71.
PENGOBATAN
1. Istirahat yang cukup
2. Pengobatan spesifik tidak ada, jadi hanya diberikan secara simptomatik saja berdasarkan keadaan klinis yang ada.
3. Dapat diberikan :
- Immunoglobulin IV (IGIV), pada pasien imunokompromis atau neonatus
- Extracorporeal membrane oxygenation.
4. Pengobatan simptomatik :
- Antiseptik di daerah mulut
- Analgesik misal parasetamol
- Cairan cukup untuk dehidrasi yang disebabkan sulit minum dan karena demam
- Pengobatan suportif lainnya ( gizi dll )
Penyakit ini adalah ?self limiting diseases?, yaitu dapat sembuh dengan sendirinya, dalam 7-10 hari, pasien perlu istirahat karena daya tahan tubuh menurun. Pasien yang dirawat adalah yang dengan gejala berat dan komplikasi tersebut diatas.
PENCEGAHAN
PENCEGAHAN DAN PENGENDALIAN PENYAKIT:
Penyakit ini sering terjadi pada masyarakat dengan sanitasi yang kurang baik. Pencegahan penyakit adalah dengan menghilangkan kekumuhan dan kepadatan lingkungan; kebersihan (Higiene dan Sanitasi) lingkungan maupun perorangan. Cara yang paling gampang dilakukan adalah misalnya membiasakan selalu cuci tangan, khususnya sehabis berdekatan dengan penderita, desinfeksi peralatan makanan, mainan, handuk yang memungkinkan terkontaminasi.
Bila perlu anak tidak bersekolah selama satu minggu setelah timbul rash sampai panas hilang. Pasien sebenarnya tak perlu diasingkan karena ekskresi virus tetap berlangsung beberapa minggu setelah gejala hilang, yang penting menjaga kebersihan perorangan.
Di Rumah sakit ?Universal Precaution? harus dilaksanakan.
Penyakit ini belum dapat dicegah dengan vaksin (Imunisasi)
UPAYA PEMERINTAH DALAM HAL INI :
Meningkatkan survailans epidemiologi (perlu definisi klinik)
Memberikan penyuluhan tentang cara-cara penularan dan pencegahan PTKM untuk memotong rantai penularan.
Memberikan penyuluhan tentang tanda-tanda dan gejala PTKM
Menjaga kebersihan perorangan.
Bila anak tidak dirawat, harus istirahat di rumah karena :
- Daya tahan tubuh menurun.
- Tidak menularkan kebalita lainnya.
Menyiapkan sarana kesehatan tentang tatalaksana PTKM termasuk pelaksanaan ?Universal Precaution?nya.

7.09.2010

my 23






assalamualaikum..

good morning,,,

today is my bday.. Thank u all for the warm wishes and prayers for me.. I really appreciate it… ^_^

alhamdulillahh....bisa hidup ampe sekarang...lebih sehat dari semalem. *semalem rasaya bumi berputar gak aturan..




ulang tahun kali ini saya lagi di depok ke tempat hubby....karna lagi disini ya dah deehh gak ada pjamas party di tengah malam yang biasa di lakukan sahabat saya vanda dan novi..kita semua lagi mengejar mimpi di tempat yang berbeda..haha

hubby mah gak bakal ada kado dan kue kuean hahaha..

tapii seminggu ini segala nya di turutin lohh *kecuali naek kereta ekonomi xixixi

mau makan apapunn bolehhh...

mau beli apapun boleehhh...*walaupun sambil "lagii???" hag hag hag..

*dan kebetulan lagi ngumpulin gamis dan maxi dress d terus terusin dahhh...

mau kemana pun dianter mau panas hujan badai sekalipun..

*walopun sempet ada tragedi 136 ribu rupiah dan jalan dari margo city ke salak....capekkk...




udah 23 euy...berharap saya lebih mature, bisa bener ngurusin kuliah, rayya dan hubby..

gak tau kenapaa...akhir akhir ini saya kapikiran hidup mulu..

mendapatkan getaran Ilahi yang sering melemah sinyalnya.

Membuat saya belajar lebih dalam tentang kehidupan, yang dengan kesombongan saya, saya pikir sudah cukup saya kuasai. Semoga Allah mengampuni.







saya ingin menjadi wanita yang lebih baik dan lebih baik..

whatever people do and say..

i just do my my best and pray for my all..









dan saya suka dengan PM teman saya d FB


tak terasa,sudah sekian lama qt hidup d dunia.

dan entah berapa lama lagi sebelum kita meninggalkan dunia ini.




tapi, kehidupan tidaklah sesingkat itu.




di sana menanti kehidupan sempurna, kekal, dan abadi.

kehidupan akhirat telah menanti.




seiring bertambahnya usia,semoga bertambah pula bekal menuju jannahNya. InsyaaLlah

7.07.2010

mempesiunkan celana bisakah??

sebelum kejakarta sempet..
ibuk sempet bilang ke aku "cewek jangan pake celana...dosa tau...kan gak boleh menyerupai laki.."
sempet juga si aku nya yang kontra gt...tapi aku tau dehh ibuk tu 1000% bener...
truss....
jadi dehhh ke jakarta ini kalo jalan yang aku cari gamis aja..maxi dress yang lucu gt..
semoga bisa hijrah dah..
*segag nya 75 % xixixixiix amiinnn..

7.03.2010

bertamasya ke malang ^^

assalamualaikum
saya baru pulang dari malang,
akhirnya keturutan juga ya liburan ama keluarga kecil saya..sebenernya udag gak berani ngarep liburan, ya walopun ini liburan semester ganjil yang pasti panjang cuman aku kan lagi ngerjain KTI dan hubby lagi ada proyek gt..
ehh ternyata ada nikahanya mas sukron dan mbak desi..jadi deh kita kemalang...
buat saya malang masih aja dingin..
kebiasaan di semarang sii..

 begitu masuk singosari rayya langsung tepar..padahal di jalan ceriwis aja



berpelukan..
ke nikahan mas sukron dan mb desi

happy wedding semoga sakinah mawadah warahmah d beri keturunan yang menyenangkan dan menentramkan hati..
aminn

 udah sampe malang gak boleh donk kalo gak jalan jalan, pilihan nya ke taman safari prigen..

rayya kek nya udah ngantuk ngantuk walaupun d jalan dy sempet tidur juga tapi pas d bilang " ya jangan tidur ya..kita bentar lagi mau ke rumah hao-harimau-" langsung semangat lagi..

finally pintu gerbang nya ketemu juga=))
cute lama

sleppy

 hello bisoon

 elephan show



with jessica =))

tiger cave

baby tiger

burruunggg


video
rayya and train

6.30.2010

L.A.Z.Y



assalamualaikum
hari ke 5 liburan nih..dan aku tetep aja belum ngapa2 in selain wisata kuliner hags hags hags,,
bener2`gak produktive selain lemak..
kemaren si lumayan udah ngutek ngutek KTI
tapi...males lagii...ngantuk lagii..diajak makan lagii...huuuff...
bener bener lazy day...
ngeposting ini aja dalam keadaan belum mandi, tapi udah makan...hhahahha

see you at next posting...

6.23.2010

and my mum say..

ada cewek aneh gak tau dehhh datang dari planet mana yang jelas dy anehh sangat aneh malah menurutku..

intinya dy melakukan hal hal yang aneh, yang bikin keributan kecil antara aku ama hubby yah yah udah menurutku, udah cukup aku ama hubby aja, gak perlu di ributin keluar luar juga

ehhhh..mendadak dangdut dy marah marah aku bilang aku munafik segala macem
pengen ya aku semprot balik nii
cuma aku keinget omongan ibuk..
"..lha terus opo yo arep mbok bales? lek jahat mbok bales jahat, opo bedane kowe karo wong kui to nduk ndukk.."
"lalu apa iya kamu mau balas? kalo kejahatan kamu balas kejahatan, apa bedanya kamu dengan dy to nduk ndukk..."


deg! *tertohok seketika

sayang energinya, dihabisin buat bete, buat marahnya, buat kepikiranya buat semua semuanya yang gak enaknya

jadi jalan keluar nya ada dua
1. maafin , lupain semuanya
2. tinggalkan, tinggalkan hal hal yang hanya membuat hidup mu berantakan
3. terus mendendam lah sampai kamu capek  huufff



When you forgive people, it's because you still want them in your life.

Pengikut

 

Design by Amanda @ Blogger Buster